Difference between revisions of "CSC111 Lab 8 2014"

From dftwiki3
Jump to: navigation, search
(Challenge 7)
(Challenge 7)
Line 296: Line 296:
 
<br />
 
<br />
 
<source lang="text">
 
<source lang="text">
DNA = """AGCCTTCTAGCGTTAATTAACTCGAGAGAGGGTTGGCGCAGTTACCTTAATCGGTTCTGT      TCCTGAGCGAAAGGGCTCAAGCACCTGTTACCTCTGTGATAACGCCAGAGTAACTCGAGC     AAAGACAAGGGAAGCTCTAACCATGTCCGAGACAAGTTGTCTAGCAGTCCCAGTTCACACTTG      ACAATCTACAAATTAGAGCACGGATCATTTACAGGCCAATCTGGCGCGTTAATCGA     TTTCCGCAAACCGCCATGCTGCATCATTACGGGAACCACACGCCGGAAGCAGGAACAGCA"""
+
DNA = """AGCCTTCTAGCGTTAATTAACTCGAGAGAGGGTTGGCGCAGTTACCTTAATCGGTTCTGT      TCCTGAGCGAAAGGGCTCAAGCACCTGTTACCTCTGTGATAACGCCAGAGTAACTCGAGC  
 +
AAAGACAAGGGAAGCTCTAACCATGTCCGAGACAAGTTGTCTAGCAGTCCCAGTTCACACTTG      ACAATCTACAAATTAGAGCACGGATCATTTACAGGCCAATCTGGCGCGTTAATCGA    
 +
TTTCCGCAAACCGCCATGCTGCATCATTACGGGAACCACACGCCGGAAGCAGGAACAGCA"""
 
</source>
 
</source>
 
<br />
 
<br />

Revision as of 16:05, 24 March 2014

--D. Thiebaut (talk) 14:01, 24 March 2014 (EDT)


This lab deals with strings and list operations, and transforming strings into lists and lists into strings.


Splitting Strings


Work in the console, and try these different commands. Observe what the different operations do.

>>> line = "The quick, red fox jumped.  It jumped over the lazy, sleepy, brown dog."
>>> line

>>> line.split()
>>> words = line.split()
>>> words

>>> words[0]

>>> words[1]

>>> words[-1]

>>> words[-2]

>>> chunks = line.split( ',' )      # split on commas
>>> chunks

>>> chunks = line.split( '.' )      # split on periods
>>> chunks

>>> words

>>> separator = "+"
>>> newLine = separator.join( words )    # join the words into a new string and use separator as the glue
>>> newLine

>>> separator = "$$$"
>>> newLine = separator.join( words )    # same but use $$$ as the glue
>>> newLine

>>> words       # verify that you still have individual words in this list

>>> newWords = [ words[0], words[3], words[4], words[7], words[8], words[12] ] # create a new list 
>>> newWords

>>> " ".join( newWords )      # join strings in newWords list with a space

Mini Assignments


The solution program for the Exercises we saw in class on Monday and Wednesday contains good models of code that can be used to answer most of the challenges in this lab.

Use the format of the program written for the exercises on lists as a model for how to format your own program, with a main() function and individual functions for the challenges.


Challenge 1

QuestionMark1.jpg
  • Use a judicious mix() of split() and join operations to convert the string
"1	China	1,339,190,000	9,596,960.00	139.54	3,705,405.45	361.42"
into a new string:
"China 1339190000"
Note 1: Notice the lack of commas in the number! (Hints: string objects have replace methods that could prove useful here!)
Note 2: that this line is taken from a table from this URL where the numbers after the country indicate a) the population, b) the area, c) the population density expressed, both expressed in or over square-kilometers, d) the area again, but in square miles, and e) the population density expressed per square-miles as well.




Challenge 2

QuestionMark2.jpg
  • Given the following list, store it into a multi-line variable called text, split it into individual lines, and apply your transformation to each line so that your program outputs only the country names and their populations.
 Bangladesh	164,425,000	144,000.00	1,141.84	55,598.69	2,957.35
 Brazil	193,364,000	8,511,965.00	22.72	3,286,486.71	58.84
 China	1,339,190,000	9,596,960.00	139.54	3,705,405.45	361.42
 Egypt	78,848,000	1,001,450.00	78.73	386,661.85	203.92
 Ethiopia	79,221,000	1,127,127.00	70.29	435,185.99	182.04
 Germany	81,757,600	357,021.00	229.00	137,846.52	593.11
 India	1,184,639,000	3,287,590.00	360.34	1,269,345.07	933.27
 Indonesia	234,181,400	1,919,440.00	122.01	741,099.62	315.99
 Iran	75,078,000	1,648,000.00	45.56	636,296.10	117.99
 Japan	127,380,000	377,835.00	337.13	145,882.85	873.17
 Mexico	108,396,211	1,972,550.00	54.95	761,605.50	142.33
 Nigeria	170,123,000	923,768.00	171.32	356,668.67	443.71
 Pakistan	170,260,000	803,940.00	211.78	310,402.84	548.51
 Phillipines	94,013,200	300,000.00	313.38	115,830.60	811.64
 Russia	141,927,297	17,075,200.00	8.31	6,592,768.87	21.53
 United-States	309,975,000	9,629,091.00	32.19	3,717,811.29	83.38
 Vietnam	85,789,573	329,560.00	260.32	127,243.78	674.21


Your first variable should be text, defined as follows:


text = """ Bangladesh	164,425,000	144,000.00	1,141.84	55,598.69	2,957.35
 Brazil	193,364,000	8,511,965.00	22.72	3,286,486.71	58.84
 China	1,339,190,000	9,596,960.00	139.54	3,705,405.45	361.42
 Egypt	78,848,000	1,001,450.00	78.73	386,661.85	203.92
 Ethiopia	79,221,000	1,127,127.00	70.29	435,185.99	182.04
 Germany	81,757,600	357,021.00	229.00	137,846.52	593.11
 India	1,184,639,000	3,287,590.00	360.34	1,269,345.07	933.27
 Indonesia	234,181,400	1,919,440.00	122.01	741,099.62	315.99
 Iran	75,078,000	1,648,000.00	45.56	636,296.10	117.99
 Japan	127,380,000	377,835.00	337.13	145,882.85	873.17
 Mexico	108,396,211	1,972,550.00	54.95	761,605.50	142.33
 Nigeria	170,123,000	923,768.00	171.32	356,668.67	443.71
 Pakistan	170,260,000	803,940.00	211.78	310,402.84	548.51
 Phillipines	94,013,200	300,000.00	313.38	115,830.60	811.64
 Russia	141,927,297	17,075,200.00	8.31	6,592,768.87	21.53
 United-States	309,975,000	9,629,091.00	32.19	3,717,811.29	83.38
 Vietnam	85,789,573	329,560.00	260.32	127,243.78	674.21"""




Challenge 3

QuestionMark3.jpg
  • Take your solution for Challenge 2 and make it output the country with the largest population.








Challenge 4

QuestionMark4.jpg
  • Same as Challenge 3, but this time make your program output the country with the largest population density.










Sorting Lists, Reversing List, finding the Min or Max of a List


Enter the different commands below in the console, and observe how Python executes each line.

>>> seven = [ "Sleepy", "Sneezy", "Bashful", "Happy", "Grumpy", "Dopey", "Doc" ]
>>> seven.sort()
>>> seven

>>> seven.reverse()
>>> seven

>>> nums = [0, 10, -200, 3, 4, 100]
>>> nums.sort()
>>> nums

>>> nums.reverse()
>>> nums
 
>>> min( nums )

>>> max( nums )


>>> dwarvesHeight = [('Doc', 2), ('Dopey', 6), ('Grumpy', 4.5), ('Happy', 7),('Bashful', 3)]
>>> dwarvesHeight.sort()
>>> dwarvesHeight

>>> heightDwarves = []
>>> for pair in dwarvesHeight:
	      name = pair[0]
	      height = pair[1]
	      heightDwarves.append( (height, name ) )

	
>>> heightDwarves

>>> heightDwarves.sort()
>>> heightDwarves

>>> heightDwarves.reverse()
>>> heightDwarves

>>> min( heightDwarves )

>>> max( heightDwarves )

>>> 


Challenge 5

QuestionMark5.jpg
  • Make your program use the original text variable and store the pairs (population, country name) into a list
  • Using sorting, reversing, using min or max, make your program output the country with the smallest population, nicely formatted (i.e. no parentheses or commas printed). This cannot be the same as the solution function for Challenge 3 or 4.
  • Similarly, make your program output the country with the largest population.
  • Make your program output the list of countries and population sorted from largest population to smallest population. The information should show the country first on each line, followed by its population.








Challenge 6

QuestionMark6.jpg
  • Make your program output the list of countries and population sorted from largest population to smallest population. The information should show the country first on each line, followed by its population.









Processing DNA Strings


A DNA string is a string composed of sequences of four nucleobase (guanine, adenine, thymine, and cytosine) represented by the letters G, A, T, and C. Assume that we have a DNA string defined as follows:

AGCCTTCTAAGGTTAATTAACTCGAGAGAGGGTTGGCGCAGTTAAAGGCCTTAATCGGTTCTGT

Figure out a way in Python to extract the string that is between the two markers AAGG. In other words create a variable called DNA equal to the string above, then use all the methods we've seen so far to isolate the string between the markers and print it.



Challenge 7

QuestionMark8.jpg
  • Assume that DNA now is a multi-line string defined as follows:


DNA = """AGCCTTCTAGCGTTAATTAACTCGAGAGAGGGTTGGCGCAGTTACCTTAATCGGTTCTGT
     TCCTGAGCGAAAGGGCTCAAGCACCTGTTACCTCTGTGATAACGCCAGAGTAACTCGAGC
     AAAGACAAGGGAAGCTCTAACCATGTCCGAGACAAGTTGTCTAGCAGTCCCAGTTCACACTTG      ACAATCTACAAATTAGAGCACGGATCATTTACAGGCCAATCTGGCGCGTTAATCGA
     TTTCCGCAAACCGCCATGCTGCATCATTACGGGAACCACACGCCGGAAGCAGGAACAGCA"""

(it might be easier to copy/paste the string when formatted in the form below:

DNA = """AGCCTTCTAGCGTTAATTAACTCGAGAGAGGGTTGGCGCAGTTACCTTAATCGGTTCTGT      TCCTGAGCGAAAGGGCTCAAGCACCTGTTACCTCTGTGATAACGCCAGAGTAACTCGAGC   
AAAGACAAGGGAAGCTCTAACCATGTCCGAGACAAGTTGTCTAGCAGTCCCAGTTCACACTTG      ACAATCTACAAATTAGAGCACGGATCATTTACAGGCCAATCTGGCGCGTTAATCGA     
TTTCCGCAAACCGCCATGCTGCATCATTACGGGAACCACACGCCGGAAGCAGGAACAGCA"""


where the markers are on separate lines. Modify your previous solution so that it works on this new string.
  • Make your program display the string between the markers on one line only.
  • Make your program output the length of the string between markers
  • Make your program display how many adenine (A) nucleobases the string between markers contains.







Coldest year in Oxford?


UKOxford.png
The page at URL http://www.metoffice.gov.uk/climate/uk/stationdata/ contains historical temperature data for different cities in the United Kingdom. You click on a red dot to get a page of temperatures for the city associated with the dot.


Once you are looking at the page indicated above, click on Oxford and get a page of recorded temperatures since 1853 in that city.

Oxford
Location: 4509E 2072N, 63 metres amsl
Estimated data is marked with a * after the value.
Missing data (more than 2 days missing in month) is marked by  ---.
Sunshine data taken from an automatic Kipp & Zonen sensor marked with a #, otherwise sunshine data taken from a Campbell Stokes recorder.
   yyyy  mm   tmax    tmin      af    rain     sun
              degC    degC    days      mm   hours
   1853   1    8.4     2.7       4    62.8     ---
   1853   2    3.2    -1.8      19    29.3     ---
   1853   3    7.7    -0.6      20    25.9     ---
   1853   4   12.6     4.5       0    60.1     ---
   1853   5   16.8     6.1       0    59.5     ---
   1853   6   20.1    10.7       0    82.0     ---
   1853   7   21.2    12.2       0    86.2     ---
   etc...


Challenge 8

QuestionMark9.jpg
  • Figure out a way in Python to find the lowest temperature ever recorded in Oxford. Make your program output the year this record occurred, and the temperature recorded that year.
  • Modify your program so that it outputs the year the l lowest temperature was recorded and the year the highest temperature was recorded, and what the actual recorded temperatures were.





Submission


Submit the program (which you should name lab8.py) to this URL: http://cs.smith.edu/~thiebaut/111b/submitL8.php