Difference between revisions of "CSC231 Final Exam 2012"
| Line 340: | Line 340: | ||
Your assignment is to write a program that will take a DNA string and output it in packed hexadecimal. So, imagining that your program contains: | Your assignment is to write a program that will take a DNA string and output it in packed hexadecimal. So, imagining that your program contains: | ||
<br /> | <br /> | ||
| − | |||
| − | DNA db 8, "ACGGTAAA" | + | DNA db 8, "ACGGTAAA" |
| − | + | ||
| − | |||
<br /> | <br /> | ||
Its output will be | Its output will be | ||
| Line 357: | Line 355: | ||
<br /> | <br /> | ||
| − | + | ||
| − | + | DNA db 21, "AACGGTAAACCCGGGTAATTT" | |
| − | DNA db 21, "AACGGTAAACCCGGGTAATTT" | + | |
| − | |||
<br /> | <br /> | ||
