Difference between revisions of "CSC334 Lab1"

From dftwiki3
Jump to: navigation, search
Line 3: Line 3:
 
In this lab we retrieve a DNA sequence in FASTA format that we can use for various experiments.
 
In this lab we retrieve a DNA sequence in FASTA format that we can use for various experiments.
  
 +
==Procedure==
 
* Point your browser to [http://www.ncbi.nlm.nih.gov/sites/entrez?db=pubmed www.ncbi.nlm.nih.gov]
 
* Point your browser to [http://www.ncbi.nlm.nih.gov/sites/entrez?db=pubmed www.ncbi.nlm.nih.gov]
 
* Select Nucleotide from the drop-down menu, and enter escherichia coli in the search box.
 
* Select Nucleotide from the drop-down menu, and enter escherichia coli in the search box.
Line 56: Line 57:
  
 
* That's it, you have your first [http://en.wikipedia.org/wiki/FASTA FASTA] sequence for a nucleotide of the E. Coli bacteria.  You can store it in a text file or copy and paste it in a program or a Web form, depending on what you want to do with it.
 
* That's it, you have your first [http://en.wikipedia.org/wiki/FASTA FASTA] sequence for a nucleotide of the E. Coli bacteria.  You can store it in a text file or copy and paste it in a program or a Web form, depending on what you want to do with it.
 +
 +
==References/Misc. Links==
 +
 +
<hr>
 +
&copy; D. Thiebaut 2008

Revision as of 16:39, 21 July 2008

Retrieving a Nucleotide (DNA) sequence from the NCBI database

In this lab we retrieve a DNA sequence in FASTA format that we can use for various experiments.

Procedure

  • Point your browser to www.ncbi.nlm.nih.gov
  • Select Nucleotide from the drop-down menu, and enter escherichia coli in the search box.
Picture 1






























  • Click on the first link, in our case on AB426820, and select FASTA in the display box. You should get something like this (note that the first line may wraps around, and should not include a carriage return):
>gi|194306025|dbj|AB426820.1| Escherichia coli ompT mRNA for outer membrane protease T, partial cds, strain: JCM 5491
TGGGAATAGTCCTGACAACCCCTATTGCGATCAGCTCTTTTGCTTCTACCGAGACTTTATCGTTTACTCC
TGACAACATAAATGCGGACATTAGTCTTGGAACTCTGAGCGGAAAAACAAAAGAGCGTGTTTATCTAGCC 
GAAGAAGGAGGCCGAAAGGTCAGTCAACTTGACTGGAAATTCAATAACGCTGCAATTATTAAAGGTGCAA
TTAATTGGGATTTGATGCCCCAGATATCTATCGGGGCTGCTGGCTGGACAACTCTCGGTAGCCGAGGTGG  
CAATATGGTCGATCGGGACTGGATGGATTCCAGTAACCCCGGAACCTGGACGGATGAAAGTAGACACCCT 
GATACACAACTCAATTATGCCAACGAATTTGATCTGAATATCAGAGGCTGGCTCCCCAACGAACCCAATT
ACCGCCTGGGACTCATGGCCGGATATCAGGAAAGCCGTTATAGCTTTACAGCCAGAGGGGGTTCCTATAT
CTACAGTTCTGAGGAGGGATTCAGAGATGATATCGGCTCCTTCCCGAATGGAGAAAGAGCAATCGGCTAC
AAACAACGTTTTAAAATGCCCTACATTGGCTTGACTGGAAGTTATCGTTATGAAGATTTTGAGCTAGGTG
GTACATTTAAATACAGCGGCTGGGTGGAAGCATTTGATAACGATGAACACTATGACCCAGGAAAAAGAAT
CACTTATCGCAGTAAAGTCAAAGACCAAAATTACTATTCTGTTGCAGTCAATGCAGGTTATTACGTAACG
CCTAATGCAAAAGTTTATATTGAAGGCGCATGGAATCGGGTTACGAATAAAAAAGGTGATACTTCACTTT
ATGATCACAATGATAACACTTCTGACTACAGCAAAAATGGTGCAGGCATAGAAAACTATAACTTCATCAC
TACTGCTGGTC
  • That's it, you have your first FASTA sequence for a nucleotide of the E. Coli bacteria. You can store it in a text file or copy and paste it in a program or a Web form, depending on what you want to do with it.

References/Misc. Links


© D. Thiebaut 2008