CSC334 DNA Align2 pde
Revision as of 20:03, 23 July 2008 by Thiebaut (talk | contribs) (New page: Back to Lab 3 <hr> <code> <pre> // DNA_Align.pde // D. Thiebaut // A Processing program for displaying exact matches of // FASTA-formatted DNA sequences //...)
// DNA_Align.pde
// D. Thiebaut
// A Processing program for displaying exact matches of
// FASTA-formatted DNA sequences
//---------------------------------------------------------------------
// ___ _ _ _
// / __| |___| |__ __ _| |___
//| (_ | / _ \ '_ \/ _` | (_-<
// \___|_\___/_.__/\__,_|_/__/
//
//---------------------------------------------------------------------
DNAString dna1, dna2;
statusClass status;
String FASTA0 = "gi|194306025|dbj|AB426820.1| Escherichia coli ompT mRNA for outer membrane protease T, partial cds, strain: JCM 5491\n"
+"TGGGAATAGTCCTGACAACCCCTATTGCGATCAGCTCTTTTGCTTCTACCGAGACTTTATCGTTTACTCC"
+"TGACAACATAAATGCGGACATTAGTCTTGGAACTCTGAGCGGAAAAACAAAAGAGCGTGTTTATCTAGCC"
+"GAAGAAGGAGGCCGAAAGGTCAGTCAACTTGACTGGAAATTCAATAACGCTGCAATTATTAAAGGTGCAA"
+"TTAATTGGGATTTGATGCCCCAGATATCTATCGGGGCTGCTGGCTGGACAACTCTCGGTAGCCGAGGTGG"
+"CAATATGGTCGATCGGGACTGGATGGATTCCAGTAACCCCGGAACCTGGACGGATGAAAGTAGACACCCT"
+"GATACACAACTCAATTATGCCAACGAATTTGATCTGAATATCAGAGGCTGGCTCCCCAACGAACCCAATT"
+"ACCGCCTGGGACTCATGGCCGGATATCAGGAAAGCCGTTATAGCTTTACAGCCAGAGGGGGTTCCTATAT"
+"CTACAGTTCTGAGGAGGGATTCAGAGATGATATCGGCTCCTTCCCGAATGGAGAAAGAGCAATCGGCTAC"
+"AAACAACGTTTTAAAATGCCCTACATTGGCTTGACTGGAAGTTATCGTTATGAAGATTTTGAGCTAGGTG"
+"GTACATTTAAATACAGCGGCTGGGTGGAAGCATTTGATAACGATGAACACTATGACCCAGGAAAAAGAAT"
+"CACTTATCGCAGTAAAGTCAAAGACCAAAATTACTATTCTGTTGCAGTCAATGCAGGTTATTACGTAACG"
+"CCTAATGCAAAAGTTTATATTGAAGGCGCATGGAATCGGGTTACGAATAAAAAAGGTGATACTTCACTTT"
+"ATGATCACAATGATAACACTTCTGACTACAGCAAAAATGGTGCAGGCATAGAAAACTATAACTTCATCAC"
+"TACTGCTGGTC";
String FASTA1 = "gi|194306025|dbj|AB426820.1| Escherichia coli ompT mRNA for outer membrane protease T, partial cds, strain: JCM 5491\n"
+"TGGGAATAGTCCTGACAACCCCTATTGCGATCAGCTCTTTTGCTTCTACCGAGACTTTATCGTTTACTCC";
String FASTA2 = "gi|194306025|dbj|AB426820.1| Escherichia coli ompT mRNA for outer membrane protease T, partial cds, strain: JCM 5491\n"
+"TGACAACATAAATGCGGACATTAGTCTTGGAACTCTGAGCGGAAAAACAAAAGAGCGTGTTTATCTAGCC";
//---------------------------------------------------------------------
// GEOMETRY
//---------------------------------------------------------------------
int WIDTH = 1000;
int MIDWIDTH = WIDTH/2;
int HEIGHT = 400;
int BORDER = 20;
int TITLELINE = 50;
int ALINE = 100;
int BLINE = 130;
int MLINE = 160;
int STATUSTOP = 190;
int STATUSWIDTH = (WIDTH-2*BORDER)/2;
int STATUSHEIGHT = HEIGHT-BORDER-STATUSTOP;
int LEGLENGTH = (BLINE-ALINE)/2; // length of leg below symbol
String MATCH = "Match:";
PFont font; // the font used to display the symbols
//---------------------------------------------------------------------
// ___ _ _ _ ___ _ _
//| \| \| | /_\ / __|_ _ _ __ | |__ ___| |
//| |) | .` |/ _ \\__ \ || | ' \| '_ \/ _ \ |
//|___/|_|\_/_/ \_\___/\_, |_|_|_|_.__/\___/_|
// |__/
// DNA Symbol Class
//---------------------------------------------------------------------
class DNASymbol {
char symbol; // the symbol
color symColor; // color of symbol
int currX; // current X coordinates
int currY; // current Y coordinates
DNASymbol() {
setSymbol( 'X' );
}
DNASymbol( char x ) {
setSymbol( x );
}
char getSymbol( ) {
return symbol;
}
//--- set a symbol to a char representation and selects its color ---
void setSymbol( char x ) {
symbol = x;
if ( x=='C' ) symColor = color( 249, 16, 85 );
else if ( x=='G' ) symColor = color( 148, 73, 232 );
else if ( x=='T' ) symColor = color( 122, 186, 221 );
else if ( x=='A' ) symColor = color( 169, 209, 169 );
else symColor = color( 200, 200, 200 );
}
//--- draws the symbol at location x,y ---
void draw( int x, int y ) {
currX = x;
currY = y;
fill( symColor );
text( str( symbol ), x, y );
}
//--- drawBarDown: draws a line below the symbol ---
void drawBarDown() {
fill( 255 );
stroke( 255 );
line( currX+textWidth( symbol )/2, currY+2, currX+textWidth( symbol )/2, currY+LEGLENGTH );
}
}
//---------------------------------------------------------------------
// ___ _ _ _ ___ _ _
//| \| \| | /_\ / __| |_ _ _(_)_ _ __ _
//| |) | .` |/ _ \\__ \ _| '_| | ' \/ _` |
//|___/|_|\_/_/ \_\___/\__|_| |_|_||_\__, |
// |___/
// DNAString Class: a class holding a DNA sequence, both as a text string
// and as an array of DNASymbol objects.
//---------------------------------------------------------------------
class DNAString {
String symbols; // the string of chars
int noSymbols; // the # of symbols
DNASymbol[] array; // the array of symbol objects (char, color)
boolean[] legs; // indicate if each symbol has a leg or not
int offsetX; // x-value of left-most position on screen
int offsetY; // y-value of screen position
int leftPadding; // amount of left padding when sequence shifts
// this is relative to leftmost position, in integer
// number of symbols
int maxLeftPadding;
//--- default constructor ---
DNAString( ) {
symbols = "";
noSymbols = 0;
offsetX = int( 2*BORDER+textWidth( MATCH ));
offsetY = ALINE;
leftPadding = 0;
}
//--- constructor ---
DNAString( String fastaString ) {
String[] list = split( fastaString, '\n' );
symbols = list[1];
noSymbols = symbols.length();
array = new DNASymbol[ noSymbols ];
legs = new boolean[ noSymbols ];
for ( int i=0; i< noSymbols; i++ ) {
array[i] = new DNASymbol( symbols.charAt(i) );
legs[i] = false;
}
offsetX = int( 2*BORDER+textWidth( MATCH ));
offsetY = ALINE;
leftPadding = (int) ( (WIDTH-BORDER-offsetX-textWidth( symbols ) ) / 2 / textWidth( "A" ) ) ;
}
void setMaxPadding( int mmax ) {
maxLeftPadding = mmax;
}
int getLeftPadding() {
return leftPadding;
}
void shiftLeft() {
leftPadding = max(0, leftPadding-1);
}
void shiftRight() {
leftPadding = min(leftPadding+1, maxLeftPadding );
}
void setOffsets( int x, int y ) {
offsetX = x;
offsetY = y;
}
//--- returns the string of symbols ---
String getText() {
return symbols;
}
int length() {
return noSymbols;
}
//--- display text using default method ---
void drawText() {
float tw = textWidth( "A" );
text( symbols, offsetX, offsetY );
}
//--- displays symbols as individual items ---
void drawSymbols() {
float tw = textWidth( "A" );
for ( int i=0; i<noSymbols; i++ ) {
array[i].draw( offsetX+int( (i+leftPadding) * tw ), offsetY );
if ( legs[i] ) array[i].drawBarDown();
}
}
//--- setLeg: add a leg to symbol at index i ---
void setLeg( int i ) {
legs[i] = true;
}
//--- erase the symbols and the legs, if any ---
void erase() {
int tw = int( textWidth( "A" ) );
fill( 0 );
stroke( 0 );
rect( offsetX+leftPadding*tw, offsetY-12, noSymbols*tw, 12+LEGLENGTH );
for ( int i=0; i<noSymbols; i++ )
legs[i] = false;
}
}
//---------------------------------------------------------------------
// _ _ ___ _
// __| |_ __ _| |_ _ _ ___/ __| |__ _ ______
//(_-< _/ _` | _| || (_-< (__| / _` (_-<_-<
///__/\__\__,_|\__|\_,_/__/\___|_\__,_/__/__/
//
//---------------------------------------------------------------------
class statusClass {
String[] lines;
int[] X;
int[] Y;
color myColor = color( 99, 66, 204 );
statusClass() {
lines = new String[5];
X = new int[5];
Y = new int[5];
for ( int i=0; i<5; i++ ) {
lines[i] = str( i+1 ) + ".";
X[i] = BORDER + int( textWidth( "A" ) );
Y[i] = STATUSTOP+22 + i * (STATUSHEIGHT / (5+1) );
}
draw();
}
void print( int i, String s ) {
lines[i] = s;
draw();
}
void draw() {
//--- erase the rectangle first ---
fill( 0 );
stroke( myColor );
rect( BORDER, STATUSTOP, STATUSWIDTH, STATUSHEIGHT );
fill( myColor );
fill( 0 );
stroke( 0 );
int tw = int( textWidth( "Status" ) );
rect( BORDER+5, STATUSTOP, tw, 12 );
fill( myColor );
text( "Status", BORDER+5, STATUSTOP+4 );
for ( int i=0; i<5; i++ )
text( lines[i], X[i], Y[i] );
}
}
//---------------------------------------------------------------------
// ___ _ _
//| __| _ _ _ __| |_(_)___ _ _ ___
//| _| || | ' \/ _| _| / _ \ ' \(_-<
//|_| \_,_|_||_\__|\__|_\___/_||_/__/
//---------------------------------------------------------------------
//---------------------------------------------------------------------
// INITFONT: initialize the fonts (must be nonproportional ---
//---------------------------------------------------------------------
void initFont( ) {
font = loadFont( "Monaco-12.vlw" );
textFont( font );
}
//---------------------------------------------------------------------
// INITWINDOW: Draw the fixed text in the window
//---------------------------------------------------------------------
void initWindow( String title ) {
color myColor = color( 99, 66, 204 );
fill( myColor );
text( title, BORDER, TITLELINE );
textSize( 12 );
text( "A:", BORDER, ALINE );
text( "B:", BORDER, BLINE );
text( "Match:", BORDER, MLINE );
//--- setup Status box ---
status = new statusClass();
status.print( 0, "Status Box" );
}
//---------------------------------------------------------------------
// SETUP: <=== STARTUP POINT. PROCESSING STARTS HERE!!!
//---------------------------------------------------------------------
void setup() {
size( WIDTH, HEIGHT );
initFont();
background( 0 );
noStroke();
//--- initialize the window ---
initWindow( "DNA Alignment" );
//--- create the first DNA string, and position it in window ---
dna1 = new DNAString( FASTA1 );
dna1.setOffsets( int( 2*BORDER+textWidth( MATCH )) , ALINE );
//--- create 2nd DNA string and position it in window ---
dna2 = new DNAString( FASTA2 );
dna2.setOffsets( int( 2*BORDER+textWidth( MATCH )) , BLINE );
//--- make each sequence know the length of the other, so that shifting
//--- is limited.
dna1.setMaxPadding( dna2.length() );
dna2.setMaxPadding( dna1.length() );
//--- find exact matches between the 2 sequences ---
findMatching();
//--- draw both sequences ---
dna1.drawSymbols();
dna2.drawSymbols();
}
//---------------------------------------------------------------------
// DRAW: This is called many times a second. Use it to do animation.
//---------------------------------------------------------------------
void draw() {
}
//---------------------------------------------------------------------
// FINDMATCHING: finds matching symbols between the two sequences in
// their current alignment.
//---------------------------------------------------------------------
void findMatching() {
int pad1 = dna1.getLeftPadding();
int pad2 = dna2.getLeftPadding();
int start1 = 0; // where we start comparing Sequence 1
int start2 = 0; // where we start comparing Sequence 2
int end1 = dna1.length()-1; // where we end looking at Sequence 1
int end2 = dna2.length()-1; // where we end looking at Sequence 2
String dnaChar1 = dna1.getText(); // String representation of Sequence 1
String dnaChar2 = dna2.getText(); // " " " " 2
//println( "pad1="+pad1+" start1="+start1+" end1="+end1);
//println( "pad2="+pad2+" start2="+start2+" end2="+end2);
//--- figure out which sequence extends past the other ---
if ( pad1 > pad2 )
start2 = pad1 - pad2;
if ( pad2 > pad1 )
start1 = pad2 - pad1;
if ( pad1+end1 > pad2+end2 )
end1 = pad2+end2+1;
if ( pad1+end1 < pad2+end2 )
end2 = pad1+end1+1;
//--- find the exact matches, and create a line between matching symbols ---
int noMatches = 0;
for ( int i=start1, j=start2; i<=end1 && j<=end2; i++, j++ )
if ( dnaChar1.charAt( i )==dnaChar2.charAt( j ) ) {
dna1.setLeg( i );
noMatches += 1;
}
//--- display result in status box ---
status.print( 0, "Number of maching symbols: " + str( noMatches ) );
}
//---------------------------------------------------------------------
// KEYPRESSED(): called every time a key is pressed. if + or = are pressed
// shift dna strings one way, if - or _ are pressed, shift the other way.
//---------------------------------------------------------------------
boolean ping=true; // do not shift both of them at once!
void keyPressed() {
//--- + or = are pressed... shift top one right, bottom one left ---
if (key=='+' || key=='=' ) {
dna1.erase();
dna2.erase();
if ( ping )
dna1.shiftLeft();
else
dna2.shiftRight();
findMatching();
dna1.drawSymbols();
dna2.drawSymbols();
}
//--- - or _ have been pressed. Shift top one left, bottom one right---
if (key=='-' || key=='_' ) {
dna1.erase();
dna2.erase();
if ( ping )
dna2.shiftLeft();
else
dna1.shiftRight();
findMatching();
dna1.drawSymbols();
dna2.drawSymbols();
}
//--- make sure next time we alternate the shifting ---
ping = !ping;
}
